Responses are plotted as mean (SEM). The ability of the stimulus associated with cocaine infusions SB-505124 HCl to reinstate extinguished cocaine-seeking was then assessed. is necessary for incentive learning processes that contribute to cue-induced reinstatement of cocaine-seeking and which may underpin relapse in drug addiction. Introduction The most challenging feature of cocaine dependency is the high risk of relapse even after long periods of abstinence. A common trigger of relapse in vulnerable individuals is exposure to environmental stimuli previously associated with drug use (Stewart et al., 1984). The enduring control over relapse by cocaine-paired stimuli displays the ability of addictive drugs to hijack neural substrates of associative reward-learning and memory that normally enable environmental stimuli paired with natural rewards (e.g., food or water) to guide adaptive actions (Robinson and Berridge, 1993; Berke and Hyman, 2000; Kauer and Malenka, 2007). However, associative reward-learning can be dissociated into a variety of psychologically and neurobiologically unique processes (Everitt et al., 2001). Consequently, understanding the psychobiological SB-505124 HCl basis of relapse is usually of considerable importance for developing effective treatments for cocaine dependency. A common neuronal substrate of associative reward-learning processes involves striatal medium spiny neurons (MSNs), which integrate mesostriatal dopaminergic signals and glutamatergic inputs arising from cortical and limbic regions (Kauer and Malenka, 2007; Goto and Grace, 2008). MSNs provide the single striatal output to motivational and motor systems and can be divided into two functionally unique populations, expressing either dopamine D1 (D1-MSNs) or D2 (D2-MSNs) receptors (Gerfen et al., 1990; Heiman et al., 2008; Valjent et al., 2009). However, the relative contributions of D1- and D2-MSNs to motivational output and the molecular events in MSNs underpinning associative reward-learning processes that contribute to relapse-like behaviors remain elusive. The metabotropic glutamate receptor, mGluR5, is particularly interesting in this context. It is involved in several forms of plasticity in striatal MSNs that are proposed to mediate associative learning and memory processes (Sung et al., 2001; Gubellini et al., 2003; Malenka and Bear, 2004; Hyman et al., 2006; Schotanus and Chergui, SB-505124 HCl 2008), and which are affected by cocaine experience (Martin et al., 2006; Kauer and Malenka, 2007; Kourrich et al., 2007; Bellone et al., 2008; Anwyl, 2009; Moussawi et al., 2009). Although mGluR5 is usually densely expressed on both D1- and D2-MSN populations (Tallaksen-Greene et al., 1998), converging lines of research would suggest that mGluR5 located specifically on D1-MSNs is usually ideally situated to influence associative SB-505124 HCl reward-learning processes that may underpin relapse brought on by drug-paired stimuli. First, there is evidence that striatal dopamine D1 receptors (D1R) play a critical role in both the consolidation of associative reward-learning remembrances (Dalley et al., 2005) and many of the long-term effects of addictive drugs (Anderson and Pierce, 2005) and second, mGluR5 appears to interact closely with D1Rs to regulate striatal neurotransmission (Paolillo et al., 1998; Voulalas et al., 2005; Schotanus and Chergui, 2008). Here, we determine the role of mGluR5 located on dopamine D1 receptor (D1R)-expressing neurons, in behaviors influenced by drug- or natural reward-paired stimuli, by generation of a novel mouse line in which mGluR5 is usually selectively knocked-down in neurons expressing the D1R. These mice reveal a necessary role of mGluR5 located on D1R-expressing neurons for highly specific associative reward-learning processes underlying cue-induced reinstatement of cocaine-seeking. Materials and Methods Mouse generation Short hairpin RNAs were designed using the sFold (sTarMir) and BLOCK-IT RNAi Designer (Invitrogen) software packages and tested in cell culture for knock-down (KD) efficiency of mGluR5 mRNA. BLOCK-iT Pol II miR RNAi Expression vector kit with GW/EmGFP-miR vector (Invitrogen) was used to place synthetic oligos to artificial miRNA context (Fig. 1hybridization. = 4C5, 0.001) and = 4, = 0.0112). Data are offered as mean + SEM, test (* 0.05, ** 0.001). Level bars 20 m. Cx, Cortex; Acb, nucleus accumbens. hybridization An 900-bp-long digoxigenin (DIG)-labeled riboprobe was utilized for mGluR5 mRNA detection. The DNA template was synthesized using the primers: ACCCCTATCTGCTCTTCCTACC and GTCTACTGAATGGAGGGACCAG. Probe was generated using a DIG RNA Labeling Kit (SP6/T7) from Roche. Brains were fixed in 4% paraformaldehyde at 4C for 48 h and 50 m free-floating vibratome sections were hybridized with the DIG-labeled probe at 70C overnight. Signal was developed using alkaline phosphatase-conjugated antigen binding fragments and 5-bromo-4-chloro-3-indolylphosphate feeding weight except for the cocaine PRPH2 self-administration phase during which mice received access to food. Experiments were conducted in accordance with European Union guidelines around the care and use of laboratory animals; experiments in Germany were approved by the local animal care committee (Karlsruhe, Germany); experiments in the UK.